Haplogroup I-M253

Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[6] It is a primary branch of Haplogroup I-M170 (I*).

Haplogroup I1 (M253)
Possible time of origin3,170–4,600[1]–5,070 BP (today's diversification)[2][3] (previously 11,000 BP[4] to 33,000 BP[5]) 27,500 (diversification with I2-FGC77992)[1]
Possible place of originNorthern Europe
AncestorI* (M170)
DescendantsI1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Defining mutationsM253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

Haplogroup I1 is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8][9][7] 37% of Norwegian males,[10][11][12] 34.8% of Danish males,[13][14][15] 34.5% of Icelandic males,[16][17][18] and about 28% of Finnish males.[19] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan".[20]

All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]

Before a reclassification in 2008,[21] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).

More than 99% of living men with I1 belong to the DF29 branch which is estimated to have emerged in 2400 BCE. [22][23] All DF29 men share a common ancestor born between 2500 and 2400 BCE. [24] The oldest ancient individual with I1-DF29 found is Oll009, a man from early Bronze Age Sweden.[25][26]

Origins

Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in three Paleolithic and Mesolithic hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:

  • A hunter-gatherer from the Azilian in Spain in 11,466 BCE classified as having a now extinct branch of I-Z2699.[27][28]
  • Burial SF11 Date: 7500 BP - The first is a DNA sample from a Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on Gotland. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*.[29][30][31][32] SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö.
  • Burial BAB5 Date: 7300-5900 BP - The second is an individual sample from Balatonszemes-Bagodomb labelled BAB5, from Neolithic Hungary.[33] BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*.[34] BAB5 had a genetic affinity to other contemporary Neolithic farmers of Central Europe.
  • Burial RISE179 Date: 4010-3776 BP - Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179.[35] The grave is located close to Abbekås on the south coast of Skåne [36] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture.[35]
  • Burial oll009 Date: 3930-3750 BP - The fourth ancient I1 sample predating the Nordic Bronze Age (1700–500 BCE) is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon".[37] Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden close to Öllsjö on the east coast of Skåne.[36] Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the Battle Axe culture and other populations of the Corded Ware horizon.[38] oll009 has Y11204 but does not seem to have Y164553 or Y11205.[39]

Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia[40][41][31] (which also is the case with other haplogroups across Europe). Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.[35][42][43]

Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.

Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2600 BC.

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]

In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[13] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".

Latest results (January 2022) published by Y-Full suggest I1 (I-M253) was formed 27,500 ybp (95 CI: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion.[44][45] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.[3]

Structure

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]

  • I-DF29 (DF29/S438); I1a
    • I-CTS6364 (CTS6364/Z2336); I1a1
      • FGC20030; I1a1a~
        • S4767; I1a1a1~
              • I-M227; I1a1a1a1a
        • A394; I1a1a2~
        • Y11221; I1a1a3~
        • A5338; I1a1a4~
      • CTS10028; I1a1b
        • I-L22 (L22/S142); I1a1b1
          • CTS11651/Z2338; I1a1b1a~
            • I-P109; I1a1b1a1
              • I-Y3662; I1a1b1a1e~
                • I-S14887; I1a1b1a1e2~
                  • I-Y11203; I1a1b1a1e2d~
                    • I-Y29630; I1a1b1a1e2d2~
            • CTS6017; I1a1b1a2
            • I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
            • CTS6868; I1a1b1a4
              • I-Z74; I1a1b1a4a
                • CTS2208; I1a1b1a4a1~
                  • I-L287; I1a1b1a4a1a
                    • I-L258 (L258/S335); I1a1b1a4a1a1
                • I-L813; I1a1b1a4a2
                • FGC12562; I1a1b1a4a3~
          • CTS11603/S4744; I1a1b1b~
            • I-FT40464
              • I-Y19934
                • I-L300 (L300/S241); I1a1b1b1a1
                • I-Y19933
                  • I-Y19932
                    • I-Y22015
                      • I-FT57000
        • FGC10477/Y13056; I1a1b2
        • A8178, A8182, A8200, A8204; I1a1b3~
        • F13534.2/Y17263.2; I1a1b4~
    • I-Z58 (S244/Z58); I1a2
      • I-Z59 (S246/Z59); I1a2a
        • I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
          • I-Z140 (Z140, Z141)
            • I-L338
            • I-F2642 (F2642)
          • I-Z73
            • I-L1302
          • I-L573
          • I-L803
        • I-Z382; I1a2a2
      • I-Z138 (S296/Z138, Z139); I1a2b
        • I-Z2541
    • I-Z63 (S243/Z63); I1a3
      • I-BY151; I1a3a
        • I-L849.2; I1a3a1
        • I-BY351; I1a3a2
            • I-CTS10345
              • I-Y10994
            • I-Y7075
        • I-S2078
          • I-S2077
            • I-Y2245 (Y2245/PR683)
              • I-L1237
                • I-FGC9550
              • I-S10360
                • I-S15301
              • I-Y7234
        • I-BY62 (BY62); I1a3a3
  • I-Z131 (Z131/S249); I1b
    • I-CTS6397; I1b1
  • I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c

Historical expansion

A timeline of the early Germanic expansions

Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[46][47] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[48]

I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237.[49] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[50][51] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[52]

Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[53] Material findings associated with the Lombards have been excavated in Crypta Balbi.

The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[54] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.

The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[55]

During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[56]

Geographical distribution

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.

Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
Albanians (Tirana)5521.82%=(12/55)3.6%=(2/55)0.0Battaglia et al. 2008
Albanians (North Macedonia)6417.2%=(11/64)4.7%=(3/64)0.0Battaglia et al. 2008
Albanians (Tirana)
Albanians (North Macedonia)
55+64=11919.33%=(23/119)4.2%=(5/119)0.0Battaglia et al. 2008
Kosovo Albanians (Pristina)1147.96%=(9/114)5.31%=(6/114)0.0Pericic et al. 2005
Albanians (Tirana)
Albanians (North Macedonia)
Kosovo Albanians (Pristina)
55+64+114=23313.73%=(32/233)4.72%=(11/233)0.0Pericic et al. 2005
Battaglia et al. 2008
Austria439.32.30.0Underhill et al. 2007
Belarus: Vitbsk100151.00.0Underhill et al. 2007
Belarus: Brest9720.61.00.0Underhill et al. 2007
Bosnia100422.00.0Rootsi et al. 2004
Bulgaria80826.64.30.0Karachanak et al. 2013
Czech Republic4731.98.50.0Underhill et al. 2007
Czech Republic5317.01.90.0Rootsi et al. 2004
Denmark12239.3% (48/122)32.8% (40/122)0.0Underhill et al. 2007
England10419.215.40.0Underhill et al. 2007
Estonia21018.614.80.5Rootsi et al. 2004
Estonia11811.9Lappalainen et al. 2008
Finland (national)28.0Lappalainen et al. 2006
Finland: West23040% (92/230)Lappalainen et al. 2008
Finland: East30619% (58/306)Lappalainen et al. 2008
Finland: Satakunta region50+Lappalainen et al. 20089
France5817.28.61.7Underhill et al. 2007
France1216.716.70.0Cann et al. 2002
France (Low Normandy)4221.411.90.0Rootsi et al. 2004
Germany1252415.20.0Underhill et al. 2007
Greece17115.82.30.0Underhill et al. 2007
Hungary11325.713.30.0Rootsi et al. 2004
Ireland100116.00.0Underhill et al. 2007
Volga Tatars5313.211.30.0Trofimova 2015
Latvia1133.5Lappalainen et al. 2008
Lithuania1644.9Lappalainen et al. 2008
Netherlands9320.4140.0Underhill et al. 2007
Norway176637% (653/1766)Stenersen et al. 2006
Russia (national)162512.50.0Cann et al. 2002
Russia: Pskov13016.95.40.0Underhill et al. 2007
Russia: Kostroma5326.411.30.0Underhill et al. 2007
Russia: Smolensk10312.61.90.0Underhill et al. 2007
Russia: Voronez9619.83.10.0Underhill et al. 2007
Russia: Arkhangelsk14515.87.60.0Underhill et al. 2007
Russia: Cossacks8924.74.50.0Underhill et al. 2007
Russia: Karelians140108.60.0Underhill et al. 2007
Russia: Karelians13215.2Lappalainen et al. 2008
Russia: Vepsa395.12.60.0Underhill et al. 2007
Slovakia7014.34.30.0Rootsi et al. 2004
Slovenia9526.37.40.0Underhill et al. 2007
Sweden (national)16035.6% (57/160)Lappalainen et al. 2008
Sweden (national)38.0Lappalainen et al. 2009
Sweden: Västra Götaland52Lappalainen et al. 2009
Switzerland1447.65.60.0Rootsi et al. 2004
Turkey5235.41.10.0Underhill et al. 2007
Ukraine: Lviv10123.84.90.0Underhill et al. 2007
Ukraine: Ivanovo-Frankiv5621.41.80.0Underhill et al. 2007
Ukraine: Hmelnitz17626.26.10.0Underhill et al. 2007
Ukraine: Cherkasy11428.14.30.0Underhill et al. 2007
Ukraine: Bilhorod5626.85.30.0Underhill et al. 2007
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[57] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[58] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253

Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[59]

The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024.[60][61] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades.[62][63] Other historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov and Illarion Ivanovich Vorontsov-Dashkov.

The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to likely have carried the I1-S2077 subclade of I1-Z63.[64][65][66]

Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be I-M253.[67] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.

Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.[68]

William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project[69]

William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project[69]

General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee.[70]

Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395.[71]

The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project.[72] The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.

President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.[73][74]

The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.[75][76]

Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.[75]

The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.[77][78]

Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1.[79][80]

Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1.[75]

The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com.[81][82][83]

Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project.[84][85][86]

Footballers Sebastian Larsson and his father Svante Larsson were found to belong to I1-Y24470 through the testing of a family member.[87][88][89][90]

Felix Kjellberg (PewDiePie) was found to belong to haplogroup I1-L22, according to testing by 23andMe.[91]

Swedish actor Björn Andrésen belongs to haplogroup I1-L22 based on the ftDNA and 23andMe tests of one of his first cousins and one uncle on the paternal side as a part of their family research.[92][93][94][95] Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.[96][97]

As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819.[98][99]

Ice hockey defenceman Börje Salming was found to carry I1-M253. On episode 6 of the first season of the Carina Bergfeldt show on Swedish television, geneticist Peter Sjölund helped Salming investigate his DNA to find out more about his Sámi roots.[100]

Markers

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253[101]

Type: SNP
Source: M (Peter Underhill of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
ISOGG HG: I1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Nucleotide alleles change (mutation): C to T

Name: M307[102]

Type: SNP
Source: M (Peter Underhill)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: TTATTGGCATTTCAGGAAGTG
Primer R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Nucleotide alleles change (mutation): G to A

Name: P30[103]

Type: SNP
Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGTGGGCTGTTTGAAAAAGA
Primer R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40[104]

Type: SNP
Source: PS (Michael Hammer and James F. Wilson)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGAGAAAAGGTGAGAAACC
Primer R: GGACAAGGGGCAGATT
YCC HG: I1
Nucleotide alleles change (mutation): C to T
Region: ARSDP

See also

References

  1. "I1 YTree". Yfull.com. 2022-04-06. Retrieved 2022-04-19.
  2. Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  3. Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
  4. Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
  5. Underhill PA, Myres NM, Rootsi S, Chow CT, Lin AA, Otillar RP, et al. (2007). "New phylogenetic relationships for Y-chromosome haplogroup I: reappraising its phylogeography and prehistory.". In Mellars P, Boyle K, Bar-Yosef O, Stringe C (eds.). Rethinking the Human Revolution. Cambridge, UK: McDonald Institute Monographs. pp. 33–42. ISBN 978-1-902937-46-5.
  6. ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
  7. Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–348. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
  8. Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden--a Y-chromosomal and mitochondrial DNA analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. S2CID 205598345.
  9. "FamilyTreeDNA – Sweden DNA PROJECT – Sverigeprojektet".
  10. Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–19. doi:10.1016/j.forsciint.2005.11.009. PMID 16337760.
  11. "FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet". www.familytreedna.com. Retrieved 2020-11-26.
  12. "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
  13. Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  14. Sanchez JJ (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–49. doi:10.1016/S0531-5131(03)01635-2 via isfg.org.
  15. "FamilyTreeDNA – Denmark DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  16. Helgason A, Sigureth ardóttir S, Nicholson J, Sykes B, Hill EW, Bradley DG, et al. (September 2000). "Estimating Scandinavian and Gaelic ancestry in the male settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC 1287529. PMID 10931763.
  17. "The Greater Nordic Regional Y-DNA Project". familytreedna. April 2021.
  18. Ebenesersdóttir SS, Sandoval-Velasco M, Gunnarsdóttir ED, Jagadeesan A, Guðmundsdóttir VB, Thordardóttir EL, et al. (June 2018). "Ancient genomes from Iceland reveal the making of a human population". Science. 360 (6392): 1028–1032. Bibcode:2018Sci...360.1028E. doi:10.1126/science.aar2625. PMID 29853688.
  19. Lappalainen T, Koivumäki S, Salmela E, Huoponen K, Sistonen P, Savontaus ML, Lahermo P (July 2006). "Regional differences among the Finns: a Y-chromosomal perspective". Gene. 376 (2): 207–15. doi:10.1016/j.gene.2006.03.004. PMID 16644145.
  20. "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
  21. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
  22. Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6 (1): 7152. doi:10.1038/ncomms8152. PMID 25988751.
  23. "Welcome to FamilyTreeDNA Discover (Beta)". FamilyTreeDNA Discover (Beta). Retrieved 2022-12-25.
  24. "I-DF29 YTree". www.yfull.com. Retrieved 2022-12-25.
  25. Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
  26. "I-Y11204 YTree". www.yfull.com. Retrieved 2022-12-25.
  27. "Welcome to FamilyTreeDNA Discover (Beta)". FamilyTreeDNA Discover (Beta). Retrieved 2022-12-25.
  28. "Haplotree.info - ancientdna.info. Map based on All Ancient DNA v. 2.07.26".
  29. Gunther T (2017). "Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" (PDF). Nature. 23: 6 via Biorxiv.
  30. SF11 – Stora Förvar, Stora Karlsö I-Z2699*. "Haplotree.info sample: SF11". haplotree.info.
  31. Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
  32. "familytreedna.com I-Z2699 tree". familytreedna. April 2021.
  33. Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". Proceedings. Biological Sciences. 282 (1805). doi:10.1098/rspb.2015.0339. PMC 4389623. PMID 25808890.
  34. "BAB5 I-Z2699*". haplotree.info.
  35. Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
  36. SkĂĽne. "Scania - Wikipedia". En.wikipedia.org. Retrieved 2022-04-19.
  37. "YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". www.yfull.com. Retrieved 2021-01-24.
  38. Malmstrom H (July 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" (PDF). Uppsala Genomics. 1: 3 via jakobssonlab.iob.uu.se/.
  39. "I-Y11204 YTree".
  40. Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences of the United States of America. 116 (19): 9469–74. Bibcode:2019PNAS..116.9469S. doi:10.1073/pnas.1818037116. PMC 6511028. PMID 30988179.
  41. Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015). "Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process". Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 370 (1660): 20130373. doi:10.1098/rstb.2013.0373. PMC 4275881. PMID 25487325.
  42. Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006). "Y-chromosome diversity in Sweden - a long-time perspective". European Journal of Human Genetics. 14 (8): 963–70. doi:10.1038/sj.ejhg.5201651. PMID 16724001. S2CID 23227271.
  43. Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
  44. Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–99. doi:10.1038/ng.3559. hdl:11858/00-001M-0000-002A-F024-C. PMC 4884158. PMID 27111036.
  45. Woodley M (February 2017). "Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" (PDF). www.biorxiv.org/. doi:10.1101/109678. S2CID 196631764. Retrieved 27 January 2021.
  46. Schmidt KH (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–52. ISSN 0935-3518. JSTOR 40849016.
  47. Bergerbrant S (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 via diva-portal.org.
  48. Teska M, Michalowski A (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron". Archaeologia Lituana. 14: 63–77. S2CID 56295624.
  49. Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017). Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries. Anthropological Genetics. p. Presentation number: AG 16.
  50. Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. PMC 6134036. PMID 30206220.
  51. Estes R (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained – Genetic Genealogy. Retrieved 2020-12-11.
  52. Labudde D (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 via ResearchGate.net.
  53. Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–14. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
  54. Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–34. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. PMC 6436108. PMID 30872528.
  55. Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. PMC 4735653. PMID 26783717.
  56. Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–96. Bibcode:2020Natur.585..390M. bioRxiv 10.1101/703405. doi:10.1038/s41586-020-2688-8. PMID 32939067. S2CID 201195157.
  57. Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002). "Y chromosome evidence for Anglo-Saxon mass migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
  58. Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003). "A Y chromosome census of the British Isles". Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. S2CID 526263.
  59. "Founding Father DNA". isogg.org.
  60. "FamilyTreeDNA – Genetic Testing for Ancestry, Family History & Genealogy". www.familytreedna.com. Retrieved 2020-12-10.
  61. "Faderslinjen, DNA". www.sikaby.se. Retrieved 2020-12-10.
  62. "FamilyTreeDNA – RussiaDNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  63. "Vår vikingahövding i österled". www.sikaby.se. Retrieved 2020-12-10.
  64. "Sample from Homo sapiens – BioSample – NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-10.
  65. Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–96. Bibcode:2020Natur.585..390M. doi:10.1038/s41586-020-2688-8. hdl:10852/83989. PMID 32939067. S2CID 221769227.
  66. Duczko W (2004). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. Brill. ISBN 978-90-04-13874-2.
  67. Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm – a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy - Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–45. doi:10.1016/j.aanat.2011.03.014. PMID 21596538.
  68. The British Invasion Finding Your Roots
  69. "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
  70. "FamilyTreeDNA – Lee Surname DNA Research Project (and Leigh, Lea, etc)". www.familytreedna.com. Retrieved 2020-12-10.
  71. "FamilyTreeDNA – I1-S4795". www.familytreedna.com. Retrieved 2020-12-10.
  72. "FamilyTreeDNA – Grimaldi Genealogy Project at FtDNA". www.familytreedna.com. Retrieved 2020-12-11.
  73. "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
  74. Hay M (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9.
  75. Maciamo E. "Haplogroup I1 (Y-DNA)". Eupedia. Retrieved 2020-12-11.
  76. Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
  77. "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
  78. "Swedenborg". Höijen (in Swedish). Retrieved 2020-12-10.
  79. "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
  80. "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
  81. "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  82. olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
  83. "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  84. "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
  85. "FamilyTreeDNA – Morse / Moss DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  86. "Peter Morse's Family Tree". www.geni.com. Retrieved 2020-12-10.
  87. "FamilyTreeDNA – Sweden DNA Project – Sverigeprojektet". www.familytreedna.com. Retrieved 2021-02-14.
  88. "Eskilstuna kommun · EM GN398 – Familjen Larsson, Torshälla ca 1900". Eskilstuna kommun (in Swedish). Retrieved 2021-02-14.
  89. "I-Y24470 YTree". www.yfull.com. Retrieved 2021-02-14.
  90. "Familjen Larssons Anfäder". hosserudkullen.se. Retrieved 2021-02-14.
  91. Archived at Ghostarchive and the Wayback Machine: "I Did A DNA Test... (I Guess Im Cancelled Now)". YouTube.
  92. "FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet". www.familytreedna.com. Retrieved 2021-02-02.
  93. Tovseth A (June 2018). "Andrésen, Färnskog & Hansen family research". Kjellivar.tripod.com. Retrieved 2 February 2021.
  94. "Personer med namnet Andresen | Släktingar.se". www.slaktingar.se. Retrieved 2021-02-02.
  95. "Björn Andresen: Min passion för mamma blev aldrig besvarad – Katarina Hahr möter". Radio Sveriges (in Swedish). Retrieved 2021-02-02.
  96. "Johan Peter Andresen – Ancestry". www.ancestry.se. Retrieved 2021-02-02.
  97. "Family tree of Daniel Andresen". Geneanet. Retrieved 2021-02-02.
  98. "FamilyTreeDNA – Pine/Pyne Genealogy DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
  99. "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
  100. Janlind F (20 February 2021). "Bianca Salming om relationen med Börje: "Känner mig hemsk"" [Bianca Salming on her relationship with Börje: "Feeling awful"]. Goteborgs-Posten (in Swedish).
  101. snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
  102. snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
  103. P30
  104. P40

Further reading

Haplogroup I databases
General Y-DNA databases

There are several public access databases featuring I-M253, including:

  1. http://www.ysearch.org/ Archived 2011-01-04 at the Wayback Machine
  2. http://www.yhrd.org/
  3. http://www.yfull.com/tree/I1/
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.